ID: 1106602572_1106602586

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1106602572 1106602586
Species Human (GRCh38) Human (GRCh38)
Location 13:31200268-31200290 13:31200320-31200342
Sequence CCGGCGCGCGCGTCCCGCCGTCC GCCCTCTCGCGGCGCCCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 184} {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!