ID: 1106603944_1106603945

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1106603944 1106603945
Species Human (GRCh38) Human (GRCh38)
Location 13:31210224-31210246 13:31210237-31210259
Sequence CCTGTTGCAGTTTACCAGAATTC ACCAGAATTCATGTTGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114} {0: 1, 1: 0, 2: 4, 3: 26, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!