ID: 1106704844_1106704847

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1106704844 1106704847
Species Human (GRCh38) Human (GRCh38)
Location 13:32269388-32269410 13:32269401-32269423
Sequence CCCTTAAGAATCAGGCCAATCAG GGCCAATCAGCCAGGCACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 123} {0: 1, 1: 1, 2: 9, 3: 145, 4: 1151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!