ID: 1106708983_1106708988

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1106708983 1106708988
Species Human (GRCh38) Human (GRCh38)
Location 13:32311413-32311435 13:32311433-32311455
Sequence CCGTGATGGTGGCTGCGGCTGGC GGCTGGCCTCCGCAGGGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 197} {0: 1, 1: 0, 2: 3, 3: 47, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!