ID: 1106776992_1106776996

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1106776992 1106776996
Species Human (GRCh38) Human (GRCh38)
Location 13:33017555-33017577 13:33017592-33017614
Sequence CCTAGAGGTGAGGGCGGGGAGGA CTGCAGGAAGAGAATGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 412} {0: 1, 1: 0, 2: 4, 3: 50, 4: 584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!