ID: 1106968051_1106968053

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1106968051 1106968053
Species Human (GRCh38) Human (GRCh38)
Location 13:35097189-35097211 13:35097229-35097251
Sequence CCTATTGAAACTGGAAGAGCTAG AATAACTTCAGATTCCTTTTGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 7, 4: 132} {0: 1, 1: 2, 2: 4, 3: 29, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!