ID: 1106984992_1106984998

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1106984992 1106984998
Species Human (GRCh38) Human (GRCh38)
Location 13:35336009-35336031 13:35336044-35336066
Sequence CCTTACACAGAGTTCCTTAGGAA TTTTTCTATCCAGGAATTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126} {0: 1, 1: 0, 2: 1, 3: 27, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!