ID: 1106995725_1106995728

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1106995725 1106995728
Species Human (GRCh38) Human (GRCh38)
Location 13:35478063-35478085 13:35478098-35478120
Sequence CCCGGTAACATGTTTGTAGACAC TTTTAACAAGATATTCTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 126} {0: 1, 1: 0, 2: 3, 3: 41, 4: 510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!