|
Left Crispr |
Right Crispr |
| Crispr ID |
1107033919 |
1107033923 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:35880972-35880994
|
13:35881024-35881046
|
| Sequence |
CCGAAATACAATGCCCTCTTAGT |
CTGAATATACAGATGAACAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 0, 3: 11, 4: 145} |
{0: 1, 1: 7, 2: 30, 3: 81, 4: 381} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|