ID: 1107058398_1107058413

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1107058398 1107058413
Species Human (GRCh38) Human (GRCh38)
Location 13:36130909-36130931 13:36130934-36130956
Sequence CCGCCCGCACGCAACGCCCCCGG CGGGCCAGGCTGGCCAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155} {0: 1, 1: 0, 2: 7, 3: 95, 4: 871}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!