ID: 1107196540_1107196549

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1107196540 1107196549
Species Human (GRCh38) Human (GRCh38)
Location 13:37659311-37659333 13:37659343-37659365
Sequence CCTTCCTCTTTCCCCCTGTGATG CTTCACTCTTTTGCCATGAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 60, 4: 456} {0: 1, 1: 0, 2: 4, 3: 19, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!