ID: 1107282421_1107282424

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1107282421 1107282424
Species Human (GRCh38) Human (GRCh38)
Location 13:38751756-38751778 13:38751804-38751826
Sequence CCTCGTTCCAAAATATCAATTAA TTTTTTTTTCTAACAAGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 196} {0: 1, 1: 1, 2: 11, 3: 188, 4: 2171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!