ID: 1107282817_1107282820

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1107282817 1107282820
Species Human (GRCh38) Human (GRCh38)
Location 13:38755945-38755967 13:38755966-38755988
Sequence CCAAGCCACAGCTGTGTCTACAT ATACTAATATTGTCATGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 243} {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!