ID: 1107455913_1107455921

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1107455913 1107455921
Species Human (GRCh38) Human (GRCh38)
Location 13:40554382-40554404 13:40554421-40554443
Sequence CCTACCAGGAATATACCTTCATA GAGCACCACTAGATGATACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 123} {0: 1, 1: 0, 2: 0, 3: 9, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!