ID: 1107510978_1107510986

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1107510978 1107510986
Species Human (GRCh38) Human (GRCh38)
Location 13:41084699-41084721 13:41084731-41084753
Sequence CCCCTCTCCATGACCACTATGGG TTTTCTCAACATGTTAACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117} {0: 1, 1: 0, 2: 0, 3: 15, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!