ID: 1107524317_1107524326

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1107524317 1107524326
Species Human (GRCh38) Human (GRCh38)
Location 13:41214709-41214731 13:41214748-41214770
Sequence CCCAAAATTGCTGTGCTTTCCCT ACCTGCTGCTGCTAGGGGAACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 45, 4: 341} {0: 1, 1: 0, 2: 2, 3: 31, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!