ID: 1107610049_1107610051

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1107610049 1107610051
Species Human (GRCh38) Human (GRCh38)
Location 13:42104037-42104059 13:42104050-42104072
Sequence CCAGTAACAGTTCAGAGGTATGT AGAGGTATGTGGTCCTAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 99} {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!