ID: 1107721582_1107721586

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1107721582 1107721586
Species Human (GRCh38) Human (GRCh38)
Location 13:43253862-43253884 13:43253898-43253920
Sequence CCTGTTCCTTGTTGCTCAGGGTA AGCCATACCTCTTGTGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 148} {0: 1, 1: 0, 2: 0, 3: 4, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!