ID: 1107730087_1107730089

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1107730087 1107730089
Species Human (GRCh38) Human (GRCh38)
Location 13:43339855-43339877 13:43339871-43339893
Sequence CCTGTGGTATTTGCCAGGAATAT GGAATATTAATGCAGACAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 180} {0: 1, 1: 0, 2: 1, 3: 26, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!