ID: 1107730933_1107730939

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1107730933 1107730939
Species Human (GRCh38) Human (GRCh38)
Location 13:43348074-43348096 13:43348106-43348128
Sequence CCTCCCTGCATCTGCTCATGCTG CCTTGGGTCTCTCCCACTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 20, 3: 95, 4: 754} {0: 1, 1: 0, 2: 2, 3: 47, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!