ID: 1107731252_1107731256

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1107731252 1107731256
Species Human (GRCh38) Human (GRCh38)
Location 13:43351276-43351298 13:43351315-43351337
Sequence CCCCAAAACACACATGCAATCTC CTGTAAAAATGAGAAAATTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 341} {0: 1, 1: 0, 2: 13, 3: 190, 4: 1447}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!