ID: 1107731873_1107731880

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1107731873 1107731880
Species Human (GRCh38) Human (GRCh38)
Location 13:43356897-43356919 13:43356924-43356946
Sequence CCACAGCAGCCCCGTGCAAGAGC AGCTAGACAAAGAAAAAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 226} {0: 1, 1: 0, 2: 12, 3: 149, 4: 1208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!