ID: 1107843739_1107843741

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1107843739 1107843741
Species Human (GRCh38) Human (GRCh38)
Location 13:44488859-44488881 13:44488880-44488902
Sequence CCCAAATTCATCTGTAGATTCAG AGCAGTATTCTTAAATCCAATGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 53, 3: 400, 4: 1999} {0: 1, 1: 0, 2: 0, 3: 21, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!