ID: 1107844046_1107844054

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1107844046 1107844054
Species Human (GRCh38) Human (GRCh38)
Location 13:44492645-44492667 13:44492681-44492703
Sequence CCTCCAAACAAAAAAAAATCACT CTGGAGGAATGGTGGAGGATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 298, 4: 2097} {0: 1, 1: 0, 2: 1, 3: 36, 4: 492}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!