ID: 1107895296_1107895302

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1107895296 1107895302
Species Human (GRCh38) Human (GRCh38)
Location 13:44956026-44956048 13:44956052-44956074
Sequence CCAGCTACTCGGGAGGCTGAGGC AGAATGGTGTGAACCCCAGGGGG
Strand - +
Off-target summary {0: 94911, 1: 257638, 2: 218586, 3: 135882, 4: 139272} {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!