ID: 1107929308_1107929312

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1107929308 1107929312
Species Human (GRCh38) Human (GRCh38)
Location 13:45293861-45293883 13:45293890-45293912
Sequence CCGAGCATGCAGAGCAACCAGAA CATGGTTCATGGAATGCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 213} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!