ID: 1107934349_1107934353

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1107934349 1107934353
Species Human (GRCh38) Human (GRCh38)
Location 13:45332449-45332471 13:45332483-45332505
Sequence CCTTGCTCTACCTCTGGACTCAG ATGCATACATAAATGAATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 353} {0: 1, 1: 0, 2: 3, 3: 74, 4: 742}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!