ID: 1107957614_1107957622

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1107957614 1107957622
Species Human (GRCh38) Human (GRCh38)
Location 13:45531789-45531811 13:45531826-45531848
Sequence CCACCATACCCAGCCAGAATCTT TGTAGTGGAGAGGAGAAAGATGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 103, 3: 808, 4: 4733} {0: 1, 1: 0, 2: 4, 3: 75, 4: 770}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!