ID: 1107988118_1107988124

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1107988118 1107988124
Species Human (GRCh38) Human (GRCh38)
Location 13:45793399-45793421 13:45793425-45793447
Sequence CCCAGATTAAGTTGTGTTCATCC AGGGGTTCCTTATTCTAACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 182, 4: 1495} {0: 1, 1: 0, 2: 0, 3: 3, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!