ID: 1108065850_1108065856

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1108065850 1108065856
Species Human (GRCh38) Human (GRCh38)
Location 13:46577029-46577051 13:46577054-46577076
Sequence CCTTTTTTCTTTCAGGCCAGCAG AAAGGTCTCTGACTTGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 407} {0: 1, 1: 0, 2: 0, 3: 13, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!