ID: 1108201062_1108201070

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1108201062 1108201070
Species Human (GRCh38) Human (GRCh38)
Location 13:48043667-48043689 13:48043716-48043738
Sequence CCACCTCTGGGTGCTTCCTCATT GCCTCTGTAGGGATTTGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 295} {0: 1, 1: 0, 2: 2, 3: 19, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!