ID: 1108244722_1108244731

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1108244722 1108244731
Species Human (GRCh38) Human (GRCh38)
Location 13:48502973-48502995 13:48503008-48503030
Sequence CCTCCTCCCGCCAGGTTTAACTG ATAAAATTACAAAAAGGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 1344} {0: 1, 1: 0, 2: 1, 3: 55, 4: 1201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!