ID: 1108302430_1108302439

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1108302430 1108302439
Species Human (GRCh38) Human (GRCh38)
Location 13:49091964-49091986 13:49092012-49092034
Sequence CCACCAAAGCCCAGTAACGGGCC TGTTATCTGCGGAAGATGGCAGG
Strand - +
Off-target summary {0: 5, 1: 150, 2: 161, 3: 88, 4: 129} {0: 1, 1: 5, 2: 204, 3: 200, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!