ID: 1108317465_1108317471

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1108317465 1108317471
Species Human (GRCh38) Human (GRCh38)
Location 13:49250875-49250897 13:49250890-49250912
Sequence CCTCATCCCCCCACTCTGGCTCT CTGGCTCTACATGTTATTAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 646} {0: 1, 1: 0, 2: 2, 3: 10, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!