ID: 1108317700_1108317704

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1108317700 1108317704
Species Human (GRCh38) Human (GRCh38)
Location 13:49253892-49253914 13:49253924-49253946
Sequence CCTCACTGTACTTTTCCAGAACA TGGCATAATGGTTAAGACAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 207} {0: 1, 1: 1, 2: 3, 3: 51, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!