ID: 1108320187_1108320198

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1108320187 1108320198
Species Human (GRCh38) Human (GRCh38)
Location 13:49281934-49281956 13:49281987-49282009
Sequence CCCCCCAGTATCTGGGATTACAG GTATTTTTAATAATAGAGACGGG
Strand - +
Off-target summary {0: 1, 1: 294, 2: 3190, 3: 7479, 4: 10884} {0: 1, 1: 7, 2: 109, 3: 1474, 4: 3529}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!