ID: 1108397803_1108397809

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1108397803 1108397809
Species Human (GRCh38) Human (GRCh38)
Location 13:50007196-50007218 13:50007228-50007250
Sequence CCCAAAAAAATAGGGCCCAGCGT CGCCTATAATCCCAGCACTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 54} {0: 9370, 1: 149078, 2: 285159, 3: 214832, 4: 149190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!