ID: 1108521607_1108521615

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1108521607 1108521615
Species Human (GRCh38) Human (GRCh38)
Location 13:51251595-51251617 13:51251612-51251634
Sequence CCCGCTGTTCCGGGTGTCCGAGA CCGAGAGGCGGGCGTCCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35} {0: 1, 1: 0, 2: 1, 3: 10, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!