ID: 1108558998_1108559007

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1108558998 1108559007
Species Human (GRCh38) Human (GRCh38)
Location 13:51624836-51624858 13:51624882-51624904
Sequence CCAGTGCAAAGGCAGGAACGTCC TCTGGGAGGAAGTGAGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99} {0: 1, 1: 0, 2: 9, 3: 85, 4: 774}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!