ID: 1108598048_1108598060

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1108598048 1108598060
Species Human (GRCh38) Human (GRCh38)
Location 13:51966698-51966720 13:51966741-51966763
Sequence CCGACGTAGACCCTGCTCTGCAC CATGGCCACAGTTCAGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 102} {0: 7, 1: 1, 2: 1, 3: 25, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!