ID: 1108605297_1108605299

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1108605297 1108605299
Species Human (GRCh38) Human (GRCh38)
Location 13:52031187-52031209 13:52031224-52031246
Sequence CCAAAACTGGCTCAGCACATTGC CATTTTTTAAAAAAAGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 207} {0: 3, 1: 9, 2: 125, 3: 839, 4: 5135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!