ID: 1108642727_1108642734

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1108642727 1108642734
Species Human (GRCh38) Human (GRCh38)
Location 13:52397520-52397542 13:52397542-52397564
Sequence CCAGTTTGTATCCAAATTTCTGG GGCCAGGTCAATGGGTCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 205} {0: 1, 1: 1, 2: 2, 3: 7, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!