ID: 1108914300_1108914305

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1108914300 1108914305
Species Human (GRCh38) Human (GRCh38)
Location 13:55588859-55588881 13:55588898-55588920
Sequence CCTAGTAACATGCCAAGAGCTGT ACTTATCTGCAGGAGATGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 200, 3: 198, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!