ID: 1109240774_1109240777

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1109240774 1109240777
Species Human (GRCh38) Human (GRCh38)
Location 13:59884493-59884515 13:59884514-59884536
Sequence CCACTCATACTCTCCTATTAGCT CTAATTCTTCAGTTCTCTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 161} {0: 1, 1: 0, 2: 3, 3: 16, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!