ID: 1109292384_1109292386

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1109292384 1109292386
Species Human (GRCh38) Human (GRCh38)
Location 13:60492373-60492395 13:60492419-60492441
Sequence CCAGCTACTGAGATAATCACTTC TCCAAATATCCCAATGAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 8, 4: 152} {0: 1, 1: 0, 2: 3, 3: 45, 4: 359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!