ID: 1109295731_1109295733

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1109295731 1109295733
Species Human (GRCh38) Human (GRCh38)
Location 13:60528205-60528227 13:60528219-60528241
Sequence CCAAGGAAGCAAAGAAGGAGTAA AAGGAGTAAGATAATGAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 396} {0: 1, 1: 0, 2: 1, 3: 25, 4: 408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!