ID: 1109719869_1109719872

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1109719869 1109719872
Species Human (GRCh38) Human (GRCh38)
Location 13:66261765-66261787 13:66261817-66261839
Sequence CCAACAAGTCTGTCTCTTTCCAG CTTTTCCCTTGAGATACCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 236} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!