ID: 1109743928_1109743931

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1109743928 1109743931
Species Human (GRCh38) Human (GRCh38)
Location 13:66595153-66595175 13:66595203-66595225
Sequence CCTGGGAACATCTCTTTGAAATG TTTTTCCACTTTCTGTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 30, 4: 223} {0: 1, 1: 0, 2: 4, 3: 49, 4: 514}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!