ID: 1109755157_1109755162

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1109755157 1109755162
Species Human (GRCh38) Human (GRCh38)
Location 13:66748877-66748899 13:66748900-66748922
Sequence CCTTGTGTCAAGGGCAGGACTAG GTGGAGATAAGTGAATCATGGGG
Strand - +
Off-target summary {0: 8, 1: 94, 2: 245, 3: 567, 4: 1359} {0: 14, 1: 739, 2: 1501, 3: 3755, 4: 7977}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!