ID: 1109759540_1109759542

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1109759540 1109759542
Species Human (GRCh38) Human (GRCh38)
Location 13:66809246-66809268 13:66809266-66809288
Sequence CCTTTTAAATACATTTTTAATAG TAGAAGAGTACCTTGAGGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 130, 4: 1180} {0: 1, 1: 0, 2: 2, 3: 33, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!